The Locus List of Restriction Enzyme SfcI
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000766 WISP2,segment pet 1 chr20:43320422-43322081 ACAGAGCAGTGACCCTGACC + WISP2,segment pet 2 chr20:43343224-43343582 CAGAGCTGACCCAAGGTCTC -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.