The Locus List of Restriction Enzyme EcoRI/MfeI
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 dm0000060 scs' chr3R:11962738-11963819 GTGCGACGAATTAACATATTTTCA + scs chr3R:7772873-7778066 GGTGGCAAATGAACTGC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.