The Locus List of Restriction Enzyme BfaI
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000759 BX647900,segment pet 1 chr7:84158563-84159146 CTCACAGCAGTGACGAAGGA - BX647900,segment pet 2 chr7:84165611-84165866 GATGTCTCAGGAGGGTGTCA +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.