Browse Data
The Locus List of Cell Line Kc167
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 dm0000041 Eip75B-RB,enhancer chr3L:18012415-18026000 GCCATTCACTTGCACCAGTTAG + Eip75B-RB,promoter chr3L:18057511-18061284 TCGTATGGCCAACAGCTGAGGGT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.