Browse Data
The Locus List of Cell Line DC2.4
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000701 jun B,-676 segment c1 NA TCAGAACAAAGGTCCTGGGGA - junb(+2108c4) NA CGCTGGCGTCACTGAGCTGAA -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.