Browse Data
The Locus List of Cell Line CH12F3-2
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000119 IgH,Sμ chr12:113423945-113425855 GCTGACATGGATTATGTGAGG - IgH,Sα chr12:113258615-113263322 GCCTAGCCCAGACCATGCCA +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.