Browse Data
The Locus List of Cell Line REX
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000024 TAL1,promoter 1 chr1:47690027-47699198 CACTCCCTCCGGTGAAATTG + CD2BP2,TIL16 chr16:30343559-30357326 GAGACCCAGAAAGAGGAA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.