Browse Data
The Locus List of Species Escherichia coli
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 ec0000001 GalR for mgl/galS,segment P14 chr:2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA PurR,segment P9 chr:1735891-1735916 AGGCCGCCCTCTTGATCGAGAATGATT NA
2 ec0000002 GalR for mgl/galS,segment P14 chr:2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA TyrR,segment P12 chr:1987617-1987638 CCGCATATAGCCAAAGCACCACTCCTCA NA
3 ec0000003 GalR for mgl/galS,segment P14 chr:2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA Hns,segment P22 chr:2783151-2783170 GCAGGCCTTTAGTTTACTGGGATGGCCAA NA
4 ec0000004 GalR for mgl/galS,segment P14 chr:2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA
5 ec0000005 GalR for mgl/galS,segment P14 chr:2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA
6 ec0000006 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA PurR,segment P9 chr:1735891-3086223 AGGCCGCCCTCTTGATCGAGAATGATT NA
7 ec0000007 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA TyrR,segment P12 chr:1987617-1987638 CCGCATATAGCCAAAGCACCACTCCTCA NA
8 ec0000008 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA MalT,segment P13 chr:2783151-2783170 CGAAAAACCTGGCCGATGGTAAAGGTG NA
9 ec0000009 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA TyrR,sgment P21 chr:2739317-2739338 GTCATGCGACGGGCGATAGAGTCTTGAT NA
10 ec0000010 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA Hns,segment P22 chr:2783151-2783170 GCAGGCCTTTAGTTTACTGGGATGGCCAA NA
11 ec0000011 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA FruR,segment P25 chr:3071835-3071850 TCATACCGAACTCGCGAACACCGTAGTG NA
12 ec0000012 GalR for galR,segment P24 chr:2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA
13 ec0000013 GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA PurR,segment P9 chr:1735891-1735916 AGGCCGCCCTCTTGATCGAGAATGATT NA
14 ec0000014 GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA TyrR,segment P12 chr:1987617-1987638 CCGCATATAGCCAAAGCACCACTCCTCA NA
15 ec0000015 GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA MalT,segment P13 chr:2248451-2248470 CGAAAAACCTGGCCGATGGTAAAGGTG NA
16 ec0000016 GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA TyrR,sgment P21 chr:2739317-2248470 GTCATGCGACGGGCGATAGAGTCTTGAT NA
17 ec0000017 GalR for galP,segment P26 chr:3086208-3086223 ATCATGCCTGACGCTAAAAAACAGGGGC NA FruR,segment P25 chr:3071835-3071850 TCATACCGAACTCGCGAACACCGTAGTG NA
18 ec0000018 PurR,segment P9 chr:1735891-1735916 AGGCCGCCCTCTTGATCGAGAATGATT NA MalT,segment P13 chr:2248451-3071850 CGAAAAACCTGGCCGATGGTAAAGGTG NA
19 ec0000019 PurR,segment P9 chr:1735891-1735916 AGGCCGCCCTCTTGATCGAGAATGATT NA TyrR,sgment P21 chr:2739317-2739338 GTCATGCGACGGGCGATAGAGTCTTGAT NA
20 ec0000020 PurR,segment P9 chr:1735891-1735916 AGGCCGCCCTCTTGATCGAGAATGATT NA FruR,segment P25 chr:3071835-3071850 TCATACCGAACTCGCGAACACCGTAGTG NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.