Browse Data
The Locus List of Species Gallus gallus
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 gg0000001 SHOX,promoter chr1:129100252-129102045 CTAAGCAAGCAGCACTTAGG + SHOX,ECS4/CNE9,segment R13 chr1:129100252-129102045 AGTTCTGTGCTGTGTAACCAC +
2 gg0000002 SHOX,promoter chr1:129100252-129102045 CTAAGCAAGCAGCACTTAGG + SHOX,ECR1,segment R5 chr1:129100252-129102045 GTTGGACACCAGAAGCATAG +
3 gg0000003 SHOX,promoter chr1:129100252-129102045 CTAAGCAAGCAGCACTTAGG + SHOX,ECR1,segment R6 chr1:129100252-129102045 CTTGTTCCAGTTCTCCTCAG +
4 gg0000004 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + HBA,erythroid-specific enhancer,-1 kb segment chr14:12068467-12071137 TGCCAAGCACTGGTAAGAG +
5 gg0000005 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + HBA,DHS-9 chr14:12068467-12071137 GCGATATTGAATGTTCTCTAGG +
6 gg0000006 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + CGTHBA,promoter chr14:12068467-12071137 TTCACAGCACAAGGGATAACT +
7 gg0000007 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + HBAD,promoter chr14:12068467-12071137 ATGCCTACAACCTGCGTG +
8 gg0000008 HBA,DHS-9 chr14:12081407-12081818 GCGATATTGAATGTTCTCTAGG + CGTHBA,promoter chr14:12081407-12081818 TTCACAGCACAAGGGATAACT +
9 gg0000009 HBA,DHS-9 chr14:12081407-12081818 GCGATATTGAATGTTCTCTAGG + HBAD,promoter chr14:12081407-12081818 ATGCCTACAACCTGCGTG +
10 gg0000010 HBA,DHS-9 chr14:12081407-12081818 GCGATATTGAATGTTCTCTAGG + HBA,erythroid-specific enhancer,-1 kb segment chr14:12081407-12081818 TGCCAAGCACTGGTAAGAG +
11 gg0000011 CGTHBA,promoter chr14:12089653-12090073 TTCACAGCACAAGGGATAACT + HBAD,promoter chr14:12089653-12090073 ATGCCTACAACCTGCGTG +
12 gg0000012 CGTHBA,promoter chr14:12088174-12090594 TTCACAGCACAAGGGATAACT + HBA,erythroid-specific enhancer,-1 kb segment chr14:12088174-12090594 TGCCAAGCACTGGTAAGAG +
13 gg0000013 HBAD,promoter chr14:12091694-12098650 ATGCCTACAACCTGCGTG - HBA,erythroid-specific enhancer,-1 kb segment chr14:12088174-12090594 TGCCAAGCACTGGTAAGAG +
14 gg0000014 HBAD,promoter chr14:12091694-12098650 ATGCCTACAACCTGCGTG - HBAA chr14:12091677-12098667 AGCCAAATGAGATGAAATAAAA +
15 gg0000015 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb ρ,promoter chr1:193715017-193716183 AGGGAGACTACGAATGCTGC +
16 gg0000016 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb A,upstream chr1:193724348-193724624 AGCCCCACTGCCATCCTT +
17 gg0000017 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb-v,enhancer chr1:193724619-193726879 CTATCAAGACTTGCACAGACCTT +
18 gg0000018 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb,insulator,HS4 chr1:193703250-193707185 GAGAATCGGGTGCAGGCTT +
19 gg0000019 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb,insulator,3'HS chr1:193729616-193737913 GGGCATTTCTACAGAGAGCAA +
20 gg0000020 Hbb,LCR HS2 chr1:193709740-193710997 CACCGTCAGCATACATTGCT + Hbb-bh1,promoter chr1:193723388-193724353 CTGAGCCCCACCCTGATG +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.