Browse Data
The Locus List of Species Saccharomyces cerevisiae
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 sc0000001 CHA1,segment P1 chrIII:16284-17036 GATTACCGATTCCTCTACTTTTGA + CHA1,segment T1 chrIII:15374-15966 GTAAGCATCAACATATCCAAAACG -
2 sc0000002 CHA1,segment R1 chrIII:16284-17036 AAGGGATGAACATAAATGGGC + CHA1,segment F1 chrIII:16284-17036 AATTCAAAAGGACGGTAAAAGAT -
3 sc0000003 INO1,segment P1 chrX:135857-136044 GAACCCGACAACAGAACAAGC + INO1,segment T1 chrX:133946-134467 GTTGAGGTAGATGCGAGAAAGTG -
4 sc0000004 INO1,segment R1 chrX:135011-135358 TATTCTGCGGTGAACCATTAATATAG + INO1,segment T1 chrX:135011-135358 GATATCCAGAATTTCAAAGAAGAAAAC -
5 sc0000005 BUD3,segment P1 NA NA NA BUD3,segment T1 NA NA NA
6 sc0000006 SEN1,segment P1 NA NA NA SEN1,segment T1 NA NA NA
7 sc0000007 SEN1,segment P1 NA NA NA SEN1,segment C1 NA NA NA
8 sc0000008 SEN1,segment P1 NA NA NA SEN1,segment C2 NA NA NA
9 sc0000009 SEN1,segment P1 NA NA NA SEN1,segment C3 NA NA NA
10 sc0000010 SEN1,segment P1 NA NA NA SEN1,segment C4 NA NA NA
11 sc0000011 SEN1,segment P1 NA NA NA SEN1,segment C6 NA NA NA
12 sc0000012 CEN4 NA NA NA CEN3 NA NA NA
13 sc0000013 Gal4 binding site NA NA NA HIS3,TATA NA NA NA
14 sc0000014 MET16,promoter,segment P1 NA NA NA MET16,terminator,segment T1 NA NA NA
15 sc0000015 INO1,promoter,segment P1 NA NA NA INO1,terminator,segment T1 NA NA NA
16 sc0000016 GAL1p,promoter,segment P1 NA NA NA GAL1p,terminator,segment T1 NA NA NA
17 sc0000017 ACTIN,promoter,segment P2 NA NA NA ACTIN,terminator,segment T2 NA NA NA
18 sc0000018 GAL10,promoter chrII:277663-280326 TCTCCAGTGAGATTTCAAGTC + GAL10,terminator chrII:274972-277463 CTTGGCAAGCATTGACTGAC -
19 sc0000019 SEN1,segment P1 NA NA NA SEN1,segment T1 NA NA NA
20 sc0000020 BLM10,segment P1 NA NA NA BLM10,segment T1 NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.