The Locus List of Restriction Enzyme NsiI
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000753 GREB1,segment pet 1 chr3:150472765-150476987 TGAGTCACCACACCCAAAGA + GREB1,segment pet 3 chr3:150454536-150459504 ACTCCGGGTGATTCAGTGTC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.