The Locus List of Restriction Enzyme BfaI & EcoRI
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000446 IGF2,promoter P2,segment 1b chr11:2163633-2163791 TGCACACTCCCTATCACAAAATCTGAAAATTCCTG - IGF2,promoter P3,2b chr11:2160913-2161631 CTGCCTGCCCGGAGACCCCAGCTCACGA -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.