The Locus List of Restriction Enzyme KpnI
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000504 WNK4, promoter chr17:40913921-40933662 GAGGTGGAAAATAGGATGGGAAGT + WNK4, enhancer chr17:40948634-40949316 GGCGTTCTTGTTTCCAGCATT -
2 mm0000363 H19,DMR3 NA NA NA Igf2,DMR2,segment IX NA NA NA
3 mm0000364 H19,DMR3 NA NA NA Igf2,DMR2,segment XII NA NA NA
4 mm0000365 H19,DMR3 NA NA NA Igf2,DMR2,segment XI NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.