The Locus List of Restriction Enzyme BglII
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000030 SNAI1,ncRNA,segment a7 chr20:48653626-48661831 CTAGGTCAGGCCCAAAGAGA - SNAI1,segment s4 chr20:48587014-48597692 ATTGGCAAGAAGGGGAAAAT -
2 hs0000031 SNAI1,ncRNA,segment a7 chr20:48653626-48661831 CTAGGTCAGGCCCAAAGAGA - Aurka,segment E chr20:54960992-54970163 CAGACCTGATTCTCACCCTCTTG -
3 hs0000059 FBXO10,promoter,MCS5A1 chr9:37582306-37584789 CAGTCTCAACCTCTCCACCTGTAA + TOMM5,+2.4kb segment,MCS5A2 chr9:37593157-37594654 CAACCCTTGGTGAGTGTTTAGAA +
4 hs0000060 FBXO10,promoter,MCS5A1 chr9:37582306-37584789 CAGTCTCAACCTCTCCACCTGTAA + FRMPD1,+14.5kb segment chr9:37604336-37607822 TTACAGGGTCGGGGATTTATAGT +
5 hs0000061 TOMM5,+2.4kb segment,MCS5A2 chr9:37593157-37594654 CAACCCTTGGTGAGTGTTTAGAA + TOMM5,+2.4kb segment,MCS5A2 chr9:37593157-37594654 CAACCCTTGGTGAGTGTTTAGAA +
6 hs0000062 MCS5A2 chr9:37589849-37593162 GGGGCTGTGCACATAGGTA + FRMPD1,+14.5kb segment chr9:37604336-37607822 TTACAGGGTCGGGGATTTATAGT +
7 hs0000135 UBE2C,promoter chr20:44434945-44441546 TAGGCATTGGTACCCAGAGCA + UBE2C,-20 kb enhancer 1 chr20:44405364-44421475 TGGCTTGCATGGCAGATTT +
8 hs0000136 UBE2C,promoter chr20:44434945-44441546 TAGGCATTGGTACCCAGAGCA + UBE2C,+14 kb enhancer 2 chr20:44425076-44427350 CCTGGGGTACTCTACCCTTAACTC +
9 hs0000137 UBE2C,promoter chr20:44434945-44441546 TAGGCATTGGTACCCAGAGCA + UBE2C,+2 kb enhancer 3 chr20:44441541-44443373 GGACAGACAGCAAGGAAATGG +
10 hs0000141 CRP,promoter chr1:159684366-159687081 CTGTCCCACCACTCTCTATCTGA + CRP,upstream segment 4 chr1:159697373-159698092 AGCAAAAGAGCAAAGGGAGA +
11 hs0000142 CRP,promoter chr1:159683977-159684371 CTTAAATTCTATACGTAAGTGAGGGGAT - CRP,downstream segment 12 chr1:159675588-159682134 CTGGTCTCTAAACATGGAGTTTTCC -
12 hs0000145 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + MUC6,5'end chr11:1038510-1038625 GGTCAGACAAGCACAA -
13 hs0000146 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + AP2A2,3'end chr14:90080592-90093793 ATGAATGAATGAATGAACGACAG -
14 hs0000147 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + AP2A2,3'end chr11:82206947-82213290 AGGCAAGTTCCTGGAA -
15 hs0000148 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + MUC6,5'end chr11:1038510-1038625 GGTCAGACAAGCACAA -
16 hs0000149 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + AP2A2,3'end chr14:90080592-90093793 ATGAATGAATGAATGAACGACAG -
17 hs0000150 MUC6,promoter chr11:1030994-1038500 TGCTGAGAGGTTGGATG - MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC +
18 hs0000151 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + MUC5AC chr11:72308931-72322821 CCTTCCACTCACCTTCAC -
19 hs0000152 MUC2,promoter chr11:1067226-1073253 CTGCCTGTAACCTCAGAC + MUC5B chr11:1242250-1247558 TCTCCCTTTGTTCTTTGTG -
20 hs0000224 HMOX1,220bp intronic enhancer chr22:35777515-35780142 GCTAGTGAGGGACAGATGCCACCAAG - HMOX1,promoter,-4.0 kb HS-2 region chr22:35771433-35774214 GAAAGCAAGCCCAGACCGGCAGC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.