The Locus List of Restriction Enzyme BtgI
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000072 TFF1,promoter NA NA NA TFF1,distal enhancer NA NA NA
2 hs0000579 TFF1,promoter,ER chr21:43786882-43789170 GGTCACGGTGGCC - TFF1,enhancer,ER chr21:43794496-43796623 GCTCACGTTGTCC -
3 hs0000745 GREB1,segment pet 2 chr2:11665189-11676211 AGGGCGTACATCTGCATGTT + GREB1,segment pet 4 chr2:11644035-11647924 CCCCAACAGCTGTGTTCATA +
4 hs0000746 GREB1,segment pet 1 chr2:11638867-11639600 GTCCTTTGCCCTGACTGTGT + GREB1,segment pet 3 chr2:11648932-11651315 ACGAAGCTTTTTCCTGGTGA +
5 hs0000747 GREB1,segment pet 1 chr2:11638867-11639600 GTCCTTTGCCCTGACTGTGT + GREB1,segment pet 4 chr2:11638867-11639600 GTCAGCCGTTCAGGATGAAG +
6 hs0000748 GREB1,segment pet 1 chr2:11638867-11639600 GTCCTTTGCCCTGACTGTGT + GREB1,segment pet 5 chr2:11676206-11679548 CTCTCCAGGGGGTTTTTGTT +
7 mm0000062 Rankl,TSS NA NA NA Rankl,mRL-D5 NA NA NA
8 mm0000063 Rankl,TSS NA NA NA TCCR,enhancer,segment T1 NA NA NA
9 mm0000064 Rankl,TSS NA NA NA TCCR,enhancer,segment T2 NA NA NA
10 mm0000065 Rankl,TSS NA NA NA TCCR,enhancer,segment T3 NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.