The Locus List of Restriction Enzyme MspI
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000521 STAR,TSS chr8:38006226-38009042 GGTCAAGGATAGAGCGATTGCCTCACACTG + STAR,segnent -3 kb,steroidogenic factor 1 chr8:38011389-38012787 AGGCTCTATCCTCCGTCTCCCACACCACCT -
2 hs0000686 EOMES,enhancer chr3:27771052-27771768 GATGACCGATTCTACCGCAAA - EOMES,promoter chr3:27764809-27765022 TTCTGATTTAGAAGCTGAGAGCTTAGG -
3 hs0000687 EOMES,enhancer chr3:27771052-27771768 GATGACCGATTCTACCGCAAA - EOMES,promoter chr3:27763529-27763619 GCGGCCATGCTTAGTGACA -
4 mm0000481 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118477056-118477486 GAGGGAATTCTGAGTAATGAAAGTG +
5 mm0000482 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118479508-118479720 CCCACGTTACTCTCCTCTCTAGTCA +
6 mm0000483 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118477056-118477486 GAGGGAATTCTGAGTAATGAAAGTG +
7 mm0000484 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118479508-118479720 CCCACGTTACTCTCCTCTCTAGTCA +
8 mm0000663 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118477056-118477486 GAGGGAATTCTGAGTAATGAAAGTG +
9 mm0000664 Eomes,enhancer chr9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT + Eomes,promoter chr9:118479508-118479720 CCCACGTTACTCTCCTCTCTAGTCA +
10 sc0000038 COX1 NA NA NA MSY1 NA NA NA
11 sc0000044 SUP4,tyrosine tRNA NA CTTGAGATCGGGCGTTCG NA 25S rRNA chrXII:451748-452581 GGACATCTGCGTTATCGTTTAACAG +
12 sc0000058 COX1 NA NA NA MSY1 NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.