The Locus List of Restriction Enzyme BamHI/BglII
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000415 Nctc1,promoter chr7:142557876-142566157 CTGTACCCGGAACAAGTTAGC - H19,promoter chr7:142568511-142580161 CAGGTGGAAAGAGCTCTTAGAGA -
2 mm0000416 Nctc1,promoter chr7:142557876-142566157 CTGTACCCGGAACAAGTTAGC - Igf2,promoter chr7:142653723-142660093 GCCATTCTCCTGGGATTAGG -
3 mm0000418 H19,promoter chr7:142568511-142580161 CAGGTGGAAAGAGCTCTTAGAGA - Nctc1,promoter chr7:142557876-142566157 CTGTACCCGGAACAAGTTAGC -
4 mm0000421 Nctc1,mesoderm enhancer chr7:142548610-142553881 ATCTTGGGATCATGCAGAGAG + Igf2,promoter chr7:142653723-142660093 GCCATTCTCCTGGGATTAGG -
5 mm0000422 Nctc1,mesoderm enhancer chr7:142548610-142553881 ATCTTGGGATCATGCAGAGAG + H19,promoter chr7:142568511-142580161 CAGGTGGAAAGAGCTCTTAGAGA -
6 gg0000021 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + HBB, LCR HS1 chr1:193714558-193717801 TCAGGAACCGTGGGTGTGT +
7 gg0000022 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + HBB, LCR HS2 chr1:193714558-193717801 CACCGTCAGCATACATTGCT +
8 gg0000023 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + HBB, LCR HS3 chr1:193714558-193717801 GCAGTCCCAGGTTGCACAA +
9 gg0000024 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + Hbb A,upstream chr1:193717796-193724856 AGCCCCACTGCCATCCTT +
10 gg0000025 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + Hbb-bh1,promoter chr1:193717796-193724856 CTGAGCCCCACCCTGATG +
11 gg0000026 Hbb A,upstream chr1:193717796-193724856 AGCCCCACTGCCATCCTT + Hbb-bh1,promoter chr1:193717796-193724856 CTGAGCCCCACCCTGATG +
12 gg0000027 Hbb A,upstream chr1:193717796-193724856 AGCCCCACTGCCATCCTT + HBB, LCR HS1 chr1:193714558-193717801 TCAGGAACCGTGGGTGTGT +
13 gg0000065 Hbb ρ,promoter chr1:193714558-193717801 AGGGAGACTACGAATGCTGC + Hbb A,upstream chr1:193717796-193724856 AGCCCCACTGCCATCCTT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.