The Locus List of Restriction Enzyme MseI
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000293 LMP1,promoter,CTCF NA NA NA OriP NA NA NA
2 hs0000294 LMP1,promoter,CTCF NA NA NA Cp/Wp NA NA NA
3 hs0000751 GREB1,segment pet 1 chr3:150440539-150440696 TCATCTGATCAAGGGCACTG - GREB1,segment pet 2 chr3:150455051-150455435 CAAAGCACTTTGCACACGAT +
4 hs0000752 GREB1,segment pet 2 chr3:150455051-150455435 CAAAGCACTTTGCACACGAT + GREB1,segment pet 3 chr3:150474271-150474485 CTCTACCACAGAACGGGAGAG +
5 hs0000794 LMP1,promoter,CTCF NA NA NA OriP NA NA NA
6 hs0000795 LMP1,promoter,CTCF NA NA NA Cp/Wp NA NA NA
7 hs0000796 LMP1,promoter,CTCF NA NA NA OriP NA NA NA
8 hs0000797 LMP1,promoter,CTCF NA NA NA Cp/Wp NA NA NA
9 sc0000053 HXK1,5' upstream activating sequence (UAS) chrVI:255386-255530 GCCCCTGAACCCCACTATT - HXK1,3'end chrVI:252622-253164 TGCACTAGAGAGAAACTGGCCT +
10 ebv0000001 Qp,promoter NA AGGTGCGCCTATCCCAGTAC NA OriP,segment DS NA AAACCGTGACAGCTCATG NA
11 ebv0000002 Qp,promoter NA AGGTGCGCCTATCCCAGTAC NA OriP,segment FR NA TGTGTGTAATTTGTCCTCC NA
12 ebv0000003 Qp,promoter NA AGGTGCGCCTATCCCAGTAC NA CTCF,10.6kb segment NA TGCGAACAATTATTAGTAGC NA
13 ebv0000004 Qp,promoter NA AGGTGCGCCTATCCCAGTAC NA Cp,promoter NA TGGCTATAATCCGTCGCTCCTC NA
14 ebv0000005 Qp,promoter NA TGGCTATAATCCGTCGCTCCTC NA OriP,segment DS NA AAACCGTGACAGCTCATG NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.