Browse Data
The Locus List of Cell Line Jurkat
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000568 TLR5,-5kb segment, GATA3 chr1:223319112-223323544 CCATCCTTCACACAACCT - TLR5,core promoter chr1:223314408-223318227 CCGTGCATCAGGAAGTTT -
2 hs0000754 RHOH,+40 kb segment,GATA3 chr4:40281333-40285736 CTTGAGCCTCCCTGAATT - RHOH,core promoter NA CAACAGGAGATCCAGTGT NA
3 hs0000758 WASF1,-79 kb segment,GATA3 chr6:110577564-110580766 GAGTTAGATTCCTGCCCT - WASF1,core promoter chr6:110500396-110505006 CAGTGGTCTGGGTTCTAT -
4 hs0000762 ARNT2,intron 7,GATA3 chr15:80767174-80770055 GGCACAATACACTGACAGA - ARNT2,core promoter chr15:80694591-80699347 CGCACACACACATTTAACCA -
5 hs0000763 MYH3,+6.5 kb segment,GATA3 chr17:10524225-10527490 CCGTCAGAGATTCTGAGT - MYH3,core promoter chr17:10559368-10562764 GAGCACCCATATCACGTT +
6 hs0000764 SERPINF1,intron 1,GATA3 chr17:1665408-1665821 CTCATCCACTCACCCTTT - SERPINF1,core promoter chr17:1663982-1665396 CACGAGACAGTGATGCAA +
7 hs0000767 CXCL4,+4.7 kb segment,GATA3 NA CACAGAGGGAAACACAAA NA CXCL4,core promoter chr4:74847232-74848618 GGATCATGATCACAGCCA -
8 hs0000828 CD68, promoter chr17:7482499-7482886 GCACCCATGTGACACTGTTG + CD68,segment primer 2 chr17:7482899-7484019 GCTCTTGGTAGTCCTGTGG -
9 hs0000829 CD68, promoter chr17:7482499-7482886 GCACCCATGTGACACTGTTG + CD68,segment primer 3 chr17:7484032-7484213 GTGCTGCGTGGGGGAAGGAC -
10 hs0000830 CD68, promoter chr17:7482499-7482886 GCACCCATGTGACACTGTTG + CD68,segment primer 6 chr17:7484342-7485026 CTGGCAGAGTCTTGTAGAGG -
11 hs0000831 CD68, promoter chr17:7482499-7482886 GCACCCATGTGACACTGTTG + CD68,segment primer 7 chr17:7484342-7485026 GTACCCTTATTTCCTCGACACG +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.