Browse Data
The Locus List of Cell Line HMEC
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000899 Brca1,5' region,segment 1 chr11:101556131-101556156 GTTTTTAATCCCTTCCTCTTCCTTTC + Brca1,exon 24,segment 4 chr11:101490317-101490347 TGCTGAGGTTAACAGTGTGTACCAGCACATC +
2 hs0000900 Brca1,adjacent 2kb,segment 2 chr11:101551699-101551724 CCACCAGCAGCTTCCTGCCTTTCATA + Brca1,exon 24,segment 4 chr11:101490317-101490347 TGCTGAGGTTAACAGTGTGTACCAGCACATC +
3 hs0000901 Brca1,adjacent 2kb,segment 2 chr11:101551699-101551724 CCACCAGCAGCTTCCTGCCTTTCATA + Brca1,intron 2,segment 3 chr11:101546841-101546866 CACCCTAAGCATTGAGACGGGCCTTT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.