Browse Data
The Locus List of Cell Line hindlimb
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000479 Pitx1 chr13:55824836-55825332 CTCTCCTGGCTCGACTCTTG + Pitx1,segment 13 chr13:55954431-55962306 GTCTATATCGCCGTCAGCAAA +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.