Browse Data
The Locus List of Cell Line Hep G2
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000071 HNF4,proximal promoter chr20:43022349-43025518 GGCTCTGACACTGCAGAGTTCTAGAAC + HNF4,distant enhancer chr20:44396501-44401920 TCGAGGGGTGGGGGTAATGGTTAATCGG NA
2 hs0000503 CYP2C9,promoter distal -2201 AP-1 site,cFos chr10:96695527-96696715 AACATTGACGCATCATCATCA - CYP2C9,promoter proximal -1930 AP site,JunD chr10:96695527-96696715 TACTAGACTGAATTACGAAAT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.