Browse Data
The Locus List of Cell Line HeLa
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000025 CIITA,promoter,segment pIV,IFNg chr16:10972352-10977879 GTGAAAGTGGCAAACCACCT - CIITA,-50kb segment, STAT1 chr16:10921880-10930719 CGGCTAGGTCACTTTCTCTA -
2 hs0000026 CIITA,-8kb segmtn, IRF1 chr16:10960422-10965212 CAACGTGCATGGTGGAAAGA + CIITA,promoter ,segment pIV,IFNg chr16:10972352-10977879 GCCCCTGAGATGAGCTAACT -
3 hs0000027 CIITA, +59kb segment,IRF1 chr16:11027443-11033290 AATGGGATTGTGTCATCTCCTGCCTAG + CIITA,-50kb segment, STAT1 chr16:10921880-10930719 CGGCTAGGTCACTTTCTCTAGTAGGGA -
4 hs0000028 CIITA, +59kb segment,IRF1 chr16:11027443-11033290 ATGGGATTGTGTCATCTCCTGCCTAGA + CIITA,-8kb segmtn, IRF1 chr16:10960422-10965212 GTGCATGGTGGAAAGATGACTGTAAGT +
5 hs0000540 IGS,segment h18 chr16:33950156-33950467 AGTCCACCCTGTACGTCAACC - IGS,segment h37 chr16:143917-143937 TCTGCCGTGAAACTGTCTGTC -
6 hs0000541 IGS,segment h42 NA TTCGCCATCTGTCTCTTTTCCC NA IGS,segment h21 NA CACAGAGAGAAAGACAGAGAC +
7 hs0000542 IGS,segment h42 NA TTCGCCATCTGTCTCTTTTCCC NA IGS,segment h24 NA AACAGACAGAGAGAAGGCCCTAG NA
8 hs0000543 IGS,segment h42 NA TTCGCCATCTGTCTCTTTTCCC NA IGS,segment h27 NA GTCGACTTTCAATAACAGTGGCC NA
9 hs0000544 IGS,segment h42 NA TTCGCCATCTGTCTCTTTTCCC NA IGS,segment h28 chr:134996-135016 GGCGGAGAAACTAAAACATCG -
10 hs0000850 LTB,exon 4 chr6:31547296-31548980 TCGTCGTCTCCCAGCCTA + LTB,promoter chr6:31543683-31544547 CACTCACCTCTTCCCTCTGG -
11 hs0000885 Ins1,-623bp segment chr19:52263796-52265179 TCTTTTTCTCTGGCATTTATTGTC + Ins1,+761bp segment chr19:52263796-52265179 R: TCATTGGTCAACTGGGCTG -
12 hs0000910 IFN-β,enhancer,chloramphenicol acetyl transferase (CAT) NA ATTCCTCTGAATAGAGAGAGG NA thymidine kinase(TK) promoter,chloramphenicol acetyl transferase (CAT) NA AATGTACCTATAACCAGACCG NA
13 hs0000911 IFN-β,enhancer,chloramphenicol acetyl transferase (CAT) NA ATTCCTCTGAATAGAGAGAGG NA sp1,chloramphenicol acetyl transferase (CAT) NA ACTTTCACTTCTCCCTTTCAG NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.