Browse Data
The Locus List of Cell Line HEK293
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000056 TNFAIP3,TT>A enhancer chr6:138229431-138234409 GTTCAGGGGTATGCCCGAAGCTAA - TNFAIP3,promoter,segment 8 chr6:138183353-138205585 TGAGTCACCTGGGCATTTCGGAA -
2 hs0000057 TNFAIP3,TT>A enhancer chr6:138229431-138234409 GTTCAGGGGTATGCCCGAAGCTAA - TNFAIP3,intron2,segmetnt 16 chr6:138183353-138205585 GGTGAGCTGGAATAGGGCTACTCA -
3 hs0000058 TNFAIP3,TT>A enhancer chr6:138229431-138234409 GTTCAGGGGTATGCCCGAAGCTAA - TNFAIP3,3'UTR,segment 24 chr6:138183353-138205585 GCAGCTGAGGGGTTCAGAGGA -
4 hs0000438 LMO2,promoter chr11:33913203-33917307 GAGCCAGAAGAAGTGGTGATTA - CAT,promoter chr11:34459688-34467291 TTAAACACTGGAGAAATCTGCTT -
5 hs0000444 HMOX1,enhancer,+220bp segment chr22:35777515-35780142 GCTAGTGAGGGACAGATGCCACCAAG - HMOX1,promoter,-4.5kb segment chr22:35771433-35774214 GAAAGCAAGCCCAGACCGGCAGC +
6 hs0000504 WNK4, promoter chr17:40913921-40933662 GAGGTGGAAAATAGGATGGGAAGT + WNK4, enhancer chr17:40948634-40949316 GGCGTTCTTGTTTCCAGCATT -
7 hs0000535 MYC,promoter chr8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT - MYC,enhancer,segment A chr8:128226126-128226838 TCTGTGGTTTTGATTGGAGAAA -
8 hs0000536 MYC,promoter chr8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT - MYC,enhancer,segment C chr8:128235179-128236036 CCATTTGAGGGTGGAAGAGC -
9 hs0000537 MYC,promoter chr8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT - MYC,enhancer,segment D chr8:128256948-128263221 GCACAGACGAGGAGCAGTC -
10 hs0000538 MYC,promoter chr8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT - MYC,enhancer,segment B chr8:128233030-128235184 TTCCCAGTCTTTTCATCTGCT -
11 hs0000539 MYC,promoter chr8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT - MYC,enhancer,segment E chr8:128226854-128233035 TCAGAGGAAAAACACAGACACC -
12 hs0000688 KCNK9,promoter chr8:140702972-140722121 CGCTGCTTTCTGGCCCCAAGC + TRAPPC9,enhancer chr8:141163544-141170921 GCCATATGTAATATACTATACGCAGGTG -
13 hs0000689 KCNK9,promoter chr8:140702972-140722121 CGCTGCTTTCTGGCCCCAAGC + PEG13,DMR chr8:141127897-141129032 GACAATGTGCATTTGATGTTGTATC -
14 hs0000690 KCNK9,promoter chr8:140702972-140722121 CGCTGCTTTCTGGCCCCAAGC + PEG13,DMR chr8:141103139-141116732 CACAGGGAAAGGTCCTTATCC -
15 hs0000691 KCNK9,promoter chr8:141163544-141170921 GCCATATGTAATATACTATACGCAGGTG - KCNK9,promoter chr8:140718568-140722121 CTTGAGTGGCCACCTACCAG +
16 hs0000692 KCNK9,promoter chr8:141163544-141170921 GCCATATGTAATATACTATACGCAGGTG - PEG1, promoter chr8:141116727-141122213 GACTTGCAGTCTGTTTCTCTTGC -
17 hs0000724 HMHO1,promoter,cAMP-response element NA GCCTCCTGGGTTCAAGCGATT NA HO-1HMHO1,promoter,E-box element chr22:35774663-35777550 CCAGTTCCTGGAATAGTGCCTGG -
18 hs0000804 DPP10,segment primer2(name differ loci) chr16:21511275-21518865 TCTTTGTCGGAATCCACTCGGTACACACAC + DPP10,segment primer7 chr16:22447033-22450608 CAAGTGCTTTATTTCTTGGCTCTGGGGAGG +
19 hs0000912 KSHV,site 129020-129040,CTCF chr:129020-129040 KSHV-129020-129040-F :CAGCCCGATGGCCCTTCAGGC + KSHV,site 69094,3' primer segment chr:66088-66108 KSHV-66088-66108-R: CATTCTATGGGAGTCATGTGT NA
20 hs0000913 KSHV,site 129020-129040,CTCF chr:129020-129040 KSHV-129020-129040-F :CAGCCCGATGGCCCTTCAGGC + KSHV,site 72888,5' primer segment chr:72568-72588 KSHV-72568-72588-F:TTAGGGTAAGAAGCTTCGGCG NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.