Browse Data
The Locus List of Cell Line H9 ES
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000678 PRSS16,schizophrenia risk SNP rs6904071 chr6:27045744-27047480 ACCCTGTGTCACCATTTATGTATAGTCCTT + PRSS16,segment H3 chr6:27209242-27211026 CATGAATCTGTTGGGCTGCGAATGGTTTAA +
2 hs0000679 PRSS16,schizophrenia risk SNP rs6904071 chr6:27045744-27047480 ACCCTGTGTCACCATTTATGTATAGTCCTT + PRSS16,segment H4 chr6:27217480-27220624 TGTACATTGTTCCCTAGATTGTCTTGCACA +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.