Browse Data
The Locus List of Cell Line G1E
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000290 Kit,+5kb segment chr5:75576519-75580064 AGCCTCAAGTCTAGTTGGGCGGTATTAGCAG + Kit,-114kb segment chr5:75459207-75465659 AACACAGGACCATTTCAGGATGAGCACTGG -
2 mm0000291 Kit,+5kb segment chr5:75576519-75580064 AGCCTCAAGTCTAGTTGGGCGGTATTAGCAG + Kit,+58kb segment chr5:75633057-75633706 AACAGTTTCCTAGTGCAGCCTGACACAGAC +
3 mm0000292 Hbb,HS2 chr7:103852510-103861236 GGCTTGAGCACAGCAGTGCTGAGTCAT - Hbb-b1 chr7:103825137-103830556 CCGAATGT TCATAATACC CCCTTCCACC -
4 mm0000294 Hbb-b1 promoter chr7:103825137-103830556 GGTGGAAGGGGGTATTATGAACATTCGG + β-globin locus LCR HS2 chr7:103852510-103861236 ATGACTCAGCACTGCTGTGCTCAAGCC +
5 mm0000527 Hbb,HS2 chr7:103852510-103861236 ATGACTCAGCACTGCTGTGCTCAAGCC + Hbb-b2 chr7:103804324-103808679 CTGCTCTTTCTTCTTCTTTACTTTACTCTCC +
6 mm0000528 Hbb,HS2 chr7:103852510-103861236 ATGACTCAGCACTGCTGTGCTCAAGCC + Hbb-b1 chr7:103825137-103830556 GGTGGAAGGGGGTATTATGAACATTCGG +
7 mm0000529 Hbb,HS2 to HS3 chr7:103861945-103863255 ACATGAGGCTACTCTATTGTCAGACTGTGC - Hbb-b1 chr7:103825137-103830556 GGTGGAAGGGGGTATTATGAACATTCGG +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.