Browse Data
The Locus List of Cell Line FL
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000886 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,CTCF chr10:21184397-21189616 GACAATTTGACATGAATTGCAAGC -
2 hs0000887 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,-36kb segment chr10:21195625-21199793 AGTAAATCTTGCTGCCCTCAAG -
3 hs0000888 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,-61kb segment chr10:21219584-21224671 TCCTTACTTCTGCTCTCAAACAC -
4 hs0000889 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,CTCF chr10:21184397-21189616 CTTTGTAGGTCACTTTCTCCAGC -
5 hs0000890 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,-68kb segment chr10:21227602-21230648 AGCAGGCTATTGTGAAAAGAGG -
6 hs0000891 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,-81kb segment chr10:21237307-21244971 CAACCTTTTCACTGGCAGAAATG -
7 hs0000892 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,CTCF chr10:21184397-21189616 GAAGACCACTTAGGTAAACACTTTG -
8 hs0000893 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,-109kb segment chr10:21266579-21274562 TGGAAAAGATCAGTAAGGCCAGA -
9 hs0000894 Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT + Myb,Hbs1I chr10:21293452-21299959 TGCTTCTTGGTCCCGGTGT -
10 hs0000895 Myb,-36 kb segment,LDB1 chr10:21195598-21199793 CTGCCCTCAAGCAAAGCTT - Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT +
11 hs0000896 Myb,-81 kb segment,LDB1 chr10:21237307-21253882 AGATTGTTTTTGGAAATAAGAAAAGCTT + Myb,promoter chr10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT +
12 hs0000897 Myb,-36 kb segment,LDB1 chr10:21237307-21253882 CTGCCCTCAAGCAAAGCTT - Myc,intron 1,CTCF chr10:21184397-21189616 GACAATTTGACATGAATTGCAAGC -
13 hs0000898 Myb,-81 kb segment,LDB1 chr10:21237307-21253882 AGATTGTTTTTGGAAATAAGAAAAGCTT + Myc,intron 1,CTCF chr10:21184397-21189616 GACAATTTGACATGAATTGCAAGC -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.