Browse Data
The Locus List of Cell Line fetal liver
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000073 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBG2 chr11:5274582-5281571 TGGCCCTATCTTCAGCCTTCTTAAACA +
2 hs0000074 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBG1-HBG2 chr11:5272306-5273006 CAATCAACCTGATAGCTTAGGGGATAAAC -
3 hs0000075 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBG1 chr11:5269664-5272311 CTCTGAAAGTGATCCATGATCTCTAACCT +
4 hs0000076 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBD chr11:5254269-5256585 GGCTCAGTTTCTCAGAAGCCAGTCT -
5 hs0000077 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBD-HBB chr11:5252458-5254274 ATCAGGAAACAGTCCAGGATCTCAATGG +
6 hs0000078 HBB,LCR HS2 to HS4 chr11:5300235-5310660 GGGCCTAGAAATTATGTAGATGGTCCTG - HBB chr11:5246903-5252463 TTCATCTCTTGACCTCCTCATCTTCAATA +
7 hs0000098 HBB,LCR HS2 to HS4 chr11:5300235-5310660 ATAGCTTGTCTATTTCTCTCTCTAACATAGTTG - HBG1-HBG2 chr11:5274582-5281571 CGTTTTGGCAATCCATTTCG -
8 hs0000099 HBB,LCR HS2 to HS4 chr11:5300235-5310660 ATAGCTTGTCTATTTCTCTCTCTAACATAGTTG - HBG1 chr11:5269664-5272311 TTCTCTGAAAGTGATCCATGATCTCT +
9 hs0000100 HBB,LCR HS2 to HS4 chr11:5300235-5310660 TCTCTAACATAGTTGTCAGCACAATGC - HBD chr11:5254269-5256585 TGGAATTAGACCCAGGAATGAAG +
10 hs0000101 HBB,LCR HS2 to HS4 chr11:5300235-5310660 ATAGCTTGTCTATTTCTCTCTCTAACATAGTTG - HBB chr11:5246903-5252463 CATGTCCCATCCAGGTGATG +
11 hs0000123 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, LCR HS1 NA NA NA
12 hs0000124 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, LCR HS2 chr11:5300249-5302174 GAACTGCTCATGCTTGGAC +
13 hs0000125 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, LCR HS3 chr11:5305481-5307392 GCCTGCATTTATTGTTGTG +
14 hs0000126 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, LCR HS4 chr11:5307387-5310701 CAAATGGGTGACTGTAGGG +
15 hs0000127 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, LCR HS5 chr11:5310713-5313337 CTGCACACTTTCAGTCCG +
16 hs0000128 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB, 3'HS1 chr11:5225323-5241474 ACATGGATAATACTGTTCCCC -
17 hs0000129 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBB,LCR HS6 NA NA NA
18 hs0000130 HBB chr11:5243046-5250850 TGGTTATGGTCAGAGCCTC + HBG1,promoter NA GAAGAAAGACCTCTATAGGACAGG NA
19 hs0000179 HBB,LCR HS4 NA NA NA HBB,LCR HS2 NA NA NA
20 hs0000297 HBB,LCR HS5 NA NA NA HBB,LCR HS1 NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.