Browse Data
The Locus List of Cell Line 70Z/3
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000343 IgK4,enhancer,Ei chr6:70725638-70727722 ACCAAAATGTCCACCAACAGT + IgKV4,promoter chr6:69226282-69232081 CACGAATACTCTCTGGTAATTGA +
2 mm0000598 IgK4,enhancer,E3' chr6:70733712-70740792 AGAAGCAGAACTGTCTAGAGACT + IgKV4,promoter chr6:69226282-69232081 CACGAATACTCTCTGGTAATTGA +
3 mm0000599 IgK4,enhancer,Ei chr6:70725638-70727722 ACCAAAATGTCCACCAACAGT + IgK4,enhancer,E3' chr6:70733712-70740792 AGAAGCAGAACTGTCTAGAGACT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.