Browse Data
The Locus List of Cell Line DT40
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 gg0000042 Ig-beta,-1.5kb to -1.0kb segment chr27:1627594-1629551 CACTGGCCCCTGCATGAG + Ig-β,-14.3kb to -13.6kb segment chr27:1639965-1640579 GCACATTCAGTGAAGGGATCTTC -
2 gg0000043 Ig-beta,-1.5kb to -1.0kb segment chr27:1627594-1629551 CACTGGCCCCTGCATGAG + RDM1 chr27:1615110-1615686 TGGTCAGCCCCGGGTTA -
3 gg0000044 Ig-beta,-1.5kb to -1.0kb segment chr27:1627594-1629551 CACTGGCCCCTGCATGAG + PLEKHM1,promoter chr27:1608484-1609084 ACGGTGAGCCTTCAGAAAGC +
4 gg0000045 PLEKHM1,promoter chr27:1608484-1609084 TGCCTTCTCGTTCTTTCAACCT + Ig-beta,-14.3kb to -13.6kb segment chr27:1608484-1609084 GCACATTCAGTGAAGGGATCTTC +
5 gg0000046 PLEKHM1,promoter,+18.6 to +24.8 from Ig-beta chr27:1608484-1609084 TGCCTTCTCGTTCTTTCAACCT + Ig-beta,-6.5kb segment chr27:1608484-1609084 CCAGGCCCTCGGTACGT +
6 gg0000047 PLEKHM1,promoter chr27:1608484-1609084 TGCCTTCTCGTTCTTTCAACCT + Ig-beta,+4.8kb to +6.1kb segment chr27:1608484-1609084 CAGTGGCCCCAGATCTACCA +
7 gg0000058 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + CGTHBA,promoter chr14:12068467-12071137 TTCACAGCACAAGGGATAACT +
8 gg0000059 HBA,major regulatory element (MRE) chr14:12068467-12071137 CTTTTGAAGCCAATGTCTCTC + HBAD,promoter chr14:12068467-12071137 ATGCCTACAACCTGCGTG +
9 gg0000060 HBA,DHS-9 chr14:12081407-12081818 GCGATATTGAATGTTCTCTAGG + CGTHBA,promoter chr14:12081407-12081818 TTCACAGCACAAGGGATAACT +
10 gg0000061 CGTHBA,promoter chr14:12089653-12090073 TTCACAGCACAAGGGATAACT + HBAD,promoter chr14:12089653-12090073 ATGCCTACAACCTGCGTG +
11 gg0000062 CGTHBA,promoter chr14:12088174-12090594 TTCACAGCACAAGGGATAACT + HBA,erythroid-specific enhancer,-1 kb segment chr14:12088174-12090594 TGCCAAGCACTGGTAAGAG +
12 gg0000063 HBAD,promoter chr14:12091694-12098650 ATGCCTACAACCTGCGTG - HBA,erythroid-specific enhancer,-1 kb segment chr14:12088174-12090594 TGCCAAGCACTGGTAAGAG +
13 gg0000064 HBAD,promoter chr14:12091694-12098650 ATGCCTACAACCTGCGTG - HBAA chr14:12091677-12098667 AGCCAAATGAGATGAAATAAAA +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.