Browse Data
The Locus List of Cell Line cortex cells
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000662 Wnt7a,promoter chr6:91418208-91418570 TCTTAAGAGACAATAAAACACAAGAAA - Wnt7a,segment 3 chr6:91285871-91297036 ATCTGGGAGTGATCCAGGTTT -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.