Browse Data
The Locus List of Cell Line ZR-75-1
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000667 BRCA1,promoter,segment S1 chr17:41279032-41279053 GCACCCCGCTTGAATTCTCACC + BRCA1,terminator 1/2,segment S13 chr17:41194531-41194560 GGGAACTAGTTCCTGTACTGCCTTTATCTC -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.