Browse Data
The Locus List of Cell Line U937
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000640 ITGB2,enhanceosome,proximal promoter chr21:46340319-46340986 TAGAAACCTCAGCTGGAGGC + ITGB2,distal enhancer chr21:46341782-46342263 GAAGGCAGAGGTGGATGGA -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.