Browse Data
The Locus List of Cell Line bone marrow fibroblast
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000340 H19,ICR chr7:142582199-142582538 AGCTTCCTTGGTCAGGCTAAACTCCTAGT + Igf2,DMR1 NA NA NA
2 mm0000341 H19,ICR chr7:142582199-142582538 AGCTTCCTTGGTCAGGCTAAACTCCTAGT + Wsb1,Nf1,IAS1,ICR,segment 1 NA NA NA
3 mm0000342 H19,ICR chr7:142582199-142582538 AGCTTCCTTGGTCAGGCTAAACTCCTAGT + Wsb1,Nf1,IAS1,ICR,segment 2 NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.