Browse Data
The Locus List of Cell Line T47D
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000666 BRCA1,promoter,segment S1 chr17:41279032-41279053 GCACCCCGCTTGAATTCTCACC + BRCA1,terminator 1/2,segment S12 chr17:41197698-41197721 CCCCAGATCCCCCACAGCCACTAC -
2 hs0000800 FGFR2,promoter chr10:123354202-123361026 TCATTCTCTAAGCTACATCTCAATAGTGCCCTCGG + FGFR2,segmetn 3 chr10:123342324-123343165 GGCAGCAGTCAGGGTTAGCCTCTTTCC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.