Browse Data
The Locus List of Cell Line SU-DHL-4
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 hs0000246 BCL2,promoter,segment 1 chr18:60989802-60993758 CAAGATGCCACATAAGGAATCAGTC/CCTTTGCTCCCACAGAGCCTCACTCTATG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 4 chr14:106170054-106187103 CAAAGAAGCCTGCTCCTAAGAACTAC -
2 hs0000247 BCL2,promoter,segment 2 chr18:60985332-60989807 TCATGTGTGTGGAGAGCGTCAAC/ATGACTGAGTACCTGAACCGGCACCTGCAC - IgH,3' enhancer,downstream of Cα1 and Cα2 site 4 chr14:106170054-106187103 CAAAGAAGCCTGCTCCTAAGAACTAC -
3 hs0000248 BCL2,promoter,segment 3 chr18:60983632-60985337 CTGGAAGAATTTGCTAAAGGGTGAAAAG/TTGGGAATCTGGAAGTCCCAACCCCTTTAG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 4 chr14:106170054-106187103 CAAAGAAGCCTGCTCCTAAGAACTAC -
4 hs0000249 BCL2,promoter,segment 1 chr18:60989802-60993758 CAAGATGCCACATAAGGAATCAGTC/CCTTTGCTCCCACAGAGCCTCACTCTATG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 5 chr14:106167944-106170059 CACTGAGCCCTGGACCAGAC -
5 hs0000250 BCL2,promoter,segment 2 chr18:60985332-60989807 TCATGTGTGTGGAGAGCGTCAAC/ATGACTGAGTACCTGAACCGGCACCTGCAC - IgH,3' enhancer,downstream of Cα1 and Cα2 site 5 chr14:106167944-106170059 CACTGAGCCCTGGACCAGAC -
6 hs0000251 BCL2,promoter,segment 3 chr18:60983632-60985337 CTGGAAGAATTTGCTAAAGGGTGAAAAG/TTGGGAATCTGGAAGTCCCAACCCCTTTAG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 5 chr14:106167944-106170059 CACTGAGCCCTGGACCAGAC -
7 hs0000252 BCL2,promoter,segment 1 chr18:60989802-60993758 CAAGATGCCACATAAGGAATCAGTC/CCTTTGCTCCCACAGAGCCTCACTCTATG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 6 chr14:106165556-106167949 GATGACTCTGAGCATCACGCTGTC -
8 hs0000253 BCL2,promoter,segment 2 chr18:60985332-60989807 TCATGTGTGTGGAGAGCGTCAAC/ATGACTGAGTACCTGAACCGGCACCTGCAC - IgH,3' enhancer,downstream of Cα1 and Cα2 site 6 chr14:106165556-106167949 GATGACTCTGAGCATCACGCTGTC -
9 hs0000254 BCL2,promoter,segment 3 chr18:60983632-60985337 CTGGAAGAATTTGCTAAAGGGTGAAAAG/TTGGGAATCTGGAAGTCCCAACCCCTTTAG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 6 chr14:106165556-106167949 GATGACTCTGAGCATCACGCTGTC -
10 hs0000255 BCL2,promoter,segment 1 chr18:60989802-60993758 CAAGATGCCACATAAGGAATCAGTC/CCTTTGCTCCCACAGAGCCTCACTCTATG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 7 chr14:106159003-106165561 GCTGCCCTCACCACCTGCTG -
11 hs0000256 BCL2,promoter,segment 2 chr18:60985332-60989807 TCATGTGTGTGGAGAGCGTCAAC/ATGACTGAGTACCTGAACCGGCACCTGCAC - IgH,3' enhancer,downstream of Cα1 and Cα2 site 7 chr14:106159003-106165561 GCTGCCCTCACCACCTGCTG -
12 hs0000257 BCL2,promoter,segment 3 chr18:60983632-60985337 CTGGAAGAATTTGCTAAAGGGTGAAAAG/TTGGGAATCTGGAAGTCCCAACCCCTTTAG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 7 chr14:106159003-106165561 GCTGCCCTCACCACCTGCTG -
13 hs0000258 BCL2,promoter,segment 1 chr18:60989802-60993758 CAAGATGCCACATAAGGAATCAGTC/CCTTTGCTCCCACAGAGCCTCACTCTATG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 8 chr14:106151813-106159008 TCCAGGGAGGACTCAAGTTTGAG -
14 hs0000259 BCL2,promoter,segment 2 chr18:60985332-60989807 TCATGTGTGTGGAGAGCGTCAAC/ATGACTGAGTACCTGAACCGGCACCTGCAC - IgH,3' enhancer,downstream of Cα1 and Cα2 site 8 chr14:106151813-106159008 TCCAGGGAGGACTCAAGTTTGAG -
15 hs0000260 BCL2,promoter,segment 3 chr18:60983632-60985337 CTGGAAGAATTTGCTAAAGGGTGAAAAG/TTGGGAATCTGGAAGTCCCAACCCCTTTAG - IgH,3' enhancer,downstream of Cα1 and Cα2 site 8 chr14:106151813-106159008 TCCAGGGAGGACTCAAGTTTGAG -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.