Browse Data
The Locus List of Cell Line primary neurons
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000162 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Tfam chr10:71224264-71227145 F 5’CCATGCGTTCTTCTGTTCCT 3’;R 5’GGAGCGAGACCCTCCTAATC 3’ +
2 mm0000163 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Tfb1m chr17:3506000-3510050 F 5’GCTTTTGTGCTGTGTCTTGG 3’;R 5’CTGTTGTATCCAGCCTGCAA 3’ -
3 mm0000164 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Tfb2m chr1:179533014-179536231 F 5’ACACACCAGAAGAGGGCATC 3’;R 5’TTTGAGAGGGGTTTTGTTGTG 3’ -
4 mm0000165 Cox6a1 chr5:115346490-115351315 F 5’TGCAGGTGTTTGTGTCACAGT 3’;R 5’TGGCAGCTCACATCTGCTAC 3’ + Tfam chr10:71224264-71227145 F 5’CCATGCGTTCTTCTGTTCCT 3’;R 5’GGAGCGAGACCCTCCTAATC 3’ +
5 mm0000166 Cox6a1 chr5:115346490-115351315 F 5’TGCAGGTGTTTGTGTCACAGT 3’;R 5’TGGCAGCTCACATCTGCTAC 3’ + Tfb1m chr17:3506000-3510050 F 5’GCTTTTGTGCTGTGTCTTGG 3’;R 5’CTGTTGTATCCAGCCTGCAA 3’ -
6 mm0000167 Cox6a1 chr5:115346490-115351315 F 5’CATTATGGTGGGCAACCTTC 3’;R 5’TCCATCTGCCATTCTCACTG 3’ + Tfb2m chr1:179533014-179536231 F 5’ACACACCAGAAGAGGGCATC 3’;R 5’TTTGAGAGGGGTTTTGTTGTG 3’ -
7 mm0000168 Cox8a chr19:7221137-7229306 F 5’CATTATGGTGGGCAACCTTC 3’;R 5’TCCATCTGCCATTCTCACTG 3’ + Tfam chr10:71224264-71227145 F 5’CCATGCGTTCTTCTGTTCCT 3’;R 5’GGAGCGAGACCCTCCTAATC 3’ +
8 mm0000169 Cox8a chr19:7221137-7229306 F 5’CATTATGGTGGGCAACCTTC 3’;R 5’TCCATCTGCCATTCTCACTG 3’ + Tfb1m chr17:3506000-3510050 F 5’GCTTTTGTGCTGTGTCTTGG 3’;R 5’CTGTTGTATCCAGCCTGCAA 3’ -
9 mm0000170 Cox8a chr19:7221137-7229306 F 5’CATTATGGTGGGCAACCTTC 3’;R 5’TCCATCTGCCATTCTCACTG 3’ + Tfb2m chr1:179533014-179536231 F 5’ACACACCAGAAGAGGGCATC 3’;R 5’TTTGAGAGGGGTTTTGTTGTG 3’ -
10 mm0000171 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Cox8a NA NA NA
11 mm0000614 Myod1 chr7:3127945-3129011 F 5′:TGACCATGTTCTTCCACTGC 3′;R 5′CAGGTGGACTGTATGCAGGA 3′ NA Mef2a chr7:67219351-67228696 F 5′TCTGGCCCACTGACCTACAT 3′;R 5′CTCACAGCCGCCTAGAACTC 3′ +
12 mm0000615 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Grin1 chr2:25314096-25317085 F 5′CTCTGTGGCGTAGGAGGAAC 3′;R 5′TTTGTGTGGTGTGGTGTGTG 3′ +
13 mm0000616 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Grin2b chr6:135398746-135402698 F 5′TTCTTCCTTTCCCCTCTTCC 3′;R 5′TTCCAGCTTGTTGGCTTTCT 3′ -
14 mm0000617 Cox4i1 chr8:120669806-120670764 TCAGCAGGTAAGAGCACTGG - Gria2 chr3:80702844-80705783 F 5′ACAATGCGCCCAGAGAGA 3′;R 5′CCCAAGAATGGAGTTTAAGTCTTT 3′ -
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.