Browse Data
The Locus List of Cell Line P3X
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000545 Ciita,promoter,segmnet pIII chr16:10487676-10488739 TTCAGGGTTGTGGTGGTAGG - Ciita,termed hypersensitive site,segment HSS1 chr16:10474151-10476795 GGAGAGCAGGTAGGTCTGATATAG +
2 mm0000546 Ciita,promoter,segmnet pIII chr16:10487676-10488739 TTCAGGGTTGTGGTGGTAGG - Ciitadistinct promoter ,segment pI chr16:10477806-10480527 TGAGCCTGATGGTGATGC +
3 mm0000547 Ciita,promoter,segmnet pIII chr16:10487676-10488739 TTCAGGGTTGTGGTGGTAGG - Ciita,termed hypersensitive site,segment HSS1 chr16:10474151-10476795 GGAGAGCAGGTAGGTCTGATATAG +
4 mm0000681 Ciita,promoter,segmnet pIII chr16:10487676-10488739 TTCAGGGTTGTGGTGGTAGG - Ciitadistinct promoter ,segment pI chr16:10477806-10480527 TGAGCCTGATGGTGATGC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.