Browse Data
The Locus List of Cell Line MPC-11
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 mm0000180 IgH,promoter NA CTGGGATGTCCACACCCTGAAAA NA IgH,HS1,HS2 chr12:113244558-113246539 GTCCCTACAGTGTCTGGATGCT +
2 mm0000181 IgH,promoter NA CTGGGATGTCCACACCCTGAAAA NA IgH,HS3B chr12:113233917-113236988 CTGTTCCAAACCTCAATCCCATGTA NA
3 mm0000182 IgH,promoter NA CTGGGATGTCCACACCCTGAAAA NA IgH,HS4 chr12:113228894-113231026 AGTCATGGCCTTTGCCCTTAGA +
4 mm0000344 IgK V,enhancer 2, segment Ed chr6:70743095-70754249 ATCCTTAGGTACATAGACAC + IgK V gene,intronic enhancer chr6:70708805-70727695 CAACCAGTATTGAGAGACTC +
5 mm0000345 IgK V,enhancer 2, segment Ed chr6:70743095-70754249 ATCCTTAGGTACATAGACAC + IgK V,enhancer 1, segment E3' chr6:70733846-70737382 CCACAAGGAATCCTGCAG +
6 mm0000346 IgK V,enhancer 1, segment E3' chr6:70733846-70737382 CCACAAGGAATCCTGCAG + IgK V gene,intronic enhancer chr6:70708805-70727695 CAACCAGTATTGAGAGACTC +
7 mm0000347 IgK V,enhancer 1, segment E3' chr6:70733846-70737382 CCACAAGGAATCCTGCAG + IgK V,downstream of the transcription termination,segment 6 chr6:70740776-70743100 CTCTCCACAGTCTCCATCG +
8 mm0000348 IgK V,downstream of the transcription termination,segment 6 chr6:70733846-70737382 CCACAAGGAATCCTGCAG + IgK V,enhancer 1, segment E3' chr6:70733846-70737382 CCACAAGGAATCCTGCAG +
9 mm0000349 IgK V gene,intronic enhancer chr6:70708805-70727695 CAACCAGTATTGAGAGACTC + IgK V,downstream of the transcription termination,segment 4 chr6:70737377-70738743 TAGGTATGTGTCCCACTGTC +
10 mm0000350 IgK V gene,intronic enhancer chr6:70708805-70727695 CAACCAGTATTGAGAGACTC + IgK V,downstream of the transcription termination,segment 5 chr6:70738738-70740781 ACAGGTGAAGAAGCAGAACTG +
11 mm0000351 IgK V,enhancer 2, segment Ed chr6:70742263-70744849 TGTCAGCTTGCCAAGTAGAC - IgK V gene,intronic enhancer chr6:70723864-70727263 CAGTCCTTTCTAAGGTTCACG +
12 mm0000352 IgK V,enhancer 2, segment Ed chr6:70742263-70744849 TGTCAGCTTGCCAAGTAGAC - IgK V,enhancer 1, segment E3' chr6:70733596-70736028 CCCAATGCTTTTGCACAGTC +
13 mm0000353 IgK V,enhancer 2, segment Ed chr6:70742263-70744849 TGTCAGCTTGCCAAGTAGAC - immunoglobulin kappa V gene kappa 21-5 region NA ACAGACACACTCCTGCTATA NA
14 mm0000354 IgK V gene,intronic enhancer chr6:70725638-70727722 TCTGTTGAGATGCCAACTC - IgK V,enhancer 1, segment E3' chr6:70733712-70740792 CAAAATTTGAGGTCATTGGG -
15 mm0000355 IgK V gene,intronic enhancer chr6:70725638-70727722 TCTGTTGAGATGCCAACTC - IgK V,enhancer 2, segment Ed chr6:70740787-70746398 GGAGTCTGCTGTCCTTACAGG -
16 mm0000356 IgK V gene,intronic enhancer chr6:70723864-70727263 CAGTCCTTTCTAAGGTTCACG + Rpia gene chr6:70763759-70765091 ATACCAACAGCCGAGGGAG +
17 mm0000357 IgK V,enhancer 1, segment E3' chr6:70733596-70736028 CCCAATGCTTTTGCACAGTC + Rpia gene chr6:70763759-70765091 ATACCAACAGCCGAGGGAG +
18 mm0000607 IgK,3'end NA NA NA IgK,Ei NA NA NA
19 mm0000608 IgK,3'end NA NA NA IgK,E3' NA NA NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.