Browse Data
The Locus List of Cell Line BCBL-1
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 her0000001 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 69163,upstream of ORF50 segment chr:69143-69163 KSHV_69143-69163-R:AAGTGGTGATCTTAGGCCAGG -
2 her0000002 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 111415F,CTCF chr:111415-111435 KSHV_111415-111435-F: CCTTGAACGCTCGAATCACGC +
3 her0000003 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 130130F,CTCF chr:130130-130150 KSHV 130130-130150-F:TGTTGCTGTGGTGCTGCTGTT NA
4 her0000004 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,133,164R,CTCF chr:133144-133164 KSHV 133144-133164-R:GACCGGCCTGGAGCTGTTTGT NA
5 her0000005 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 111,480,3' end of the latency transcript segment NA NA NA
6 her0000006 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 69036,CTCF chr:69036-69056 KSHV 69036-69056-F: GACGGAAGCCTCTAGCTCTCT NA
7 her0000007 KSHV,site 129211,CTCF chr:129180-129200 TAGGACAGAAAGGTCACCTGG + KSHV,site 72818,CTCF chr:72818-72838 KSHV_72818-72838-F: TCTCGAATGAGGACCAAAGGC NA
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.