Browse Data
The Locus List of Cell Line Arabidopsis thaliana
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 at0000006 TFL1,TSS,segment A chr5:1026282-1026305 CGTTAGTGGGTTTTGTTCTTCGTG - MADS-box regulators binding region(D) chr5:1023240-1023263 ATGGCACATGTGTAGATAACCCTT +
2 at0000007 TFL2,TSS,segment B chr5:1025736-1025761 GATAATGGGGAGAGTGGTAGGAGATG - MADS-box regulators binding region(D) chr5:1023240-1023263 ATGGCACATGTGTAGATAACCCTT +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.